# pylint: disable=W0621,C0114,C0116,W0212,W0613
import pathlib
from dae.genomic_resources.gene_models import GeneModels
from dae.genomic_resources.reference_genome import ReferenceGenome
from dae.genomic_resources.repository import GenomicResourceRepo
from dae.genomic_resources.repository_factory import (
build_genomic_resource_repository,
)
from dae.genotype_storage.genotype_storage import GenotypeStorage
from dae.gpf_instance import GPFInstance
from dae.testing import setup_gene_models, setup_genome, setup_gpf_instance
GENOME_CONTENT = (
">chr1\n"
"""TTGTGTGAAGATGGAGGTAGGCCAGTTTCCCGGAGAGGTGAACAGACATTC"""
# 0 1 1 2 3 4 5
# 1 6 1 6 6 7 6 1
# ====|M1|E2---------|F3|P4|G5|E6--------|T7|F8
"""CATACAACCATGGTGAAATAGTCCTTCCTGTTACACAAG"""
# |H9|T0|T1|M2|V3|K|S =============
# 5 7 8 8 9
# 2 2 0 4 0
#
"""NNNNNNNNAT"""
# 9 1
# 1 0
# 0
"""AAGGATGGGGCTTCAGTCATCAGCGTGATGACCCTAGGATCTCACCTTTTTCCCATT"""
# ============|S<|D |D |A |H |H<|G<|-----------|K |K |G |N<
# 1 1 1 1 1 1 1 1 1 1
# 0 1 1 1 2 3 3 4 5 5
# 1 0 3 5 8 01 3 6 5 7
"""GGGGTCTGCCATCTTGGGAAAGAACTCCTGTTGGCCTACCTGTGCCTCAAANN"""
# |P |D<|A<|M<|==============------------=========
# 1 1 1 1 11 1 1 2 2
# 5 6 6 6 67 8 9 0 1
# 8 0 3 6 90 3 6 4 0
)
# This content follows the 'refflat' gene model format
# Coordinates in refflat gene models are 0-base.
# Regions are half open. Closed at the start and open at the end - [start, end)
GMM_CONTENT = """
#geneName name chrom strand txStart txEnd cdsStart cdsEnd exonCount exonStarts exonEnds
t4 tx1 chr1 + 5 84 10 71 3 5,25,45 16,37,84
c8 tx1 chr1 - 100 204 112 169 3 100,145,195 133,183,204
""" # noqa
[docs]
def t4c8_genome(root_path: pathlib.Path) -> ReferenceGenome:
return setup_genome(
root_path / "t4c8_genome" / "chrAll.fa", GENOME_CONTENT)
[docs]
def t4c8_genes(root_path: pathlib.Path) -> GeneModels:
return setup_gene_models(
root_path / "t4c8_genes" / "genes.txt",
GMM_CONTENT, fileformat="refflat")
[docs]
def t4c8_grr(
root_path: pathlib.Path,
) -> GenomicResourceRepo:
t4c8_genome(root_path)
t4c8_genes(root_path)
return build_genomic_resource_repository({
"id": "t4c8_local",
"type": "directory",
"directory": str(root_path),
})
[docs]
def t4c8_gpf(
root_path: pathlib.Path,
storage: GenotypeStorage | None = None,
) -> GPFInstance:
local_repo = t4c8_grr(root_path)
gpf_instance = setup_gpf_instance(
root_path / "gpf_instance",
reference_genome_id="t4c8_genome",
gene_models_id="t4c8_genes",
grr=local_repo)
if storage:
gpf_instance\
.genotype_storages\
.register_default_storage(storage)
return gpf_instance