Source code for dae.testing.t4c8_import

# pylint: disable=W0621,C0114,C0116,W0212,W0613
import pathlib

from dae.genomic_resources.gene_models import GeneModels
from dae.genomic_resources.reference_genome import ReferenceGenome
from dae.genomic_resources.repository import GenomicResourceRepo
from dae.genomic_resources.repository_factory import (
    build_genomic_resource_repository,
)
from dae.genotype_storage.genotype_storage import GenotypeStorage
from dae.gpf_instance import GPFInstance
from dae.testing import setup_gene_models, setup_genome, setup_gpf_instance

GENOME_CONTENT = (
    ">chr1\n"
    """TTGTGTGAAGATGGAGGTAGGCCAGTTTCCCGGAGAGGTGAACAGACATTC"""
    #  0         1    1         2          3        4    5
    #  1     6   1    6         6          7        6    1
    #        ====|M1|E2---------|F3|P4|G5|E6--------|T7|F8
    """CATACAACCATGGTGAAATAGTCCTTCCTGTTACACAAG"""
    #  |H9|T0|T1|M2|V3|K|S =============
    #  5                   7       8   8     9
    #  2                   2       0   4     0
    #
    """NNNNNNNNAT"""
    #  9        1
    #  1        0
    #           0
    """AAGGATGGGGCTTCAGTCATCAGCGTGATGACCCTAGGATCTCACCTTTTTCCCATT"""
    #  ============|S<|D |D |A |H |H<|G<|-----------|K |K |G |N<
    #  1        1  1 1            1  1 1            1        1 1
    #  0        1  1 1            2  3 3            4        5 5
    #  1        0  3 5            8 01 3            6        5 7
    """GGGGTCTGCCATCTTGGGAAAGAACTCCTGTTGGCCTACCTGTGCCTCAAANN"""
    #  |P |D<|A<|M<|==============------------=========
    #  1 1  1  1  11             1            1       2    2
    #  5 6  6  6  67             8            9       0    1
    #  8 0  3  6  90             3            6       4    0
)


# This content follows the 'refflat' gene model format
# Coordinates in refflat gene models are 0-base.
# Regions are half open. Closed at the start and open at the end - [start, end)
GMM_CONTENT = """
#geneName name chrom strand txStart txEnd cdsStart cdsEnd exonCount exonStarts  exonEnds 
t4        tx1  chr1  +      5       84    10       71     3         5,25,45     16,37,84
c8        tx1  chr1  -      100     204   112      169    3         100,145,195 133,183,204
"""  # noqa


[docs] def t4c8_genome(root_path: pathlib.Path) -> ReferenceGenome: return setup_genome(root_path / "t4c8_genome" / "chrAll.fa", GENOME_CONTENT)
[docs] def t4c8_genes(root_path: pathlib.Path) -> GeneModels: return setup_gene_models( root_path / "t4c8_genes" / "genes.txt", GMM_CONTENT, fileformat="refflat")
[docs] def t4c8_grr( root_path: pathlib.Path, ) -> GenomicResourceRepo: t4c8_genome(root_path) t4c8_genes(root_path) return build_genomic_resource_repository({ "id": "t4c8_local", "type": "directory", "directory": str(root_path), })
[docs] def t4c8_gpf( root_path: pathlib.Path, storage: GenotypeStorage | None = None, ) -> GPFInstance: local_repo = t4c8_grr(root_path) gpf_instance = setup_gpf_instance( root_path / "gpf_instance", reference_genome_id="t4c8_genome", gene_models_id="t4c8_genes", grr=local_repo) if storage: gpf_instance\ .genotype_storages\ .register_default_storage(storage) return gpf_instance