Source code for gain.genomic_resources.testing.builders

"""Fluent, immutable test-data builders for GRR resources.

This module offers a small builder DSL for composing genomic resources
into a filesystem GRR that a test can open and read back.  Builders are
immutable (frozen dataclasses); every ``with_*`` method returns a NEW
builder, so a partly-configured builder can be shared across test
variations without leaking state.

The builders assemble a pure in-memory recipe with no side effects; the
``build_*`` methods delegate the actual file writing and repository
construction to the existing helpers in
:mod:`gain.genomic_resources.testing` (``setup_directories`` and
``build_filesystem_test_repository``, or ``build_inmemory_test_resource``
for the one builder with an in-memory exit).

Example::

    def test_it(tmp_path):
        repo = (
            a_grr()
            .with_resource(
                "scores/pos",
                a_position_score()
                .with_score("phastCons", "float")
                .with_data('''
                    chrom  pos_begin  phastCons
                    1      10         0.1
                    1      11         0.2
                '''),
            )
            .build_repo(tmp_path)
        )
        score = PositionScore(repo.get_resource("scores/pos")).open()
        assert score.get_scores_at_position("1", 10) == (0.1,)
"""
# One module on purpose: the builders share the resource-realize helpers
# and the ``with_*`` idiom, and a test imports several of them together.
# pylint: disable=too-many-lines
from __future__ import annotations

import contextlib
import copy
import dataclasses
import gzip
import pathlib
import shutil
import tempfile
import textwrap
from collections.abc import Generator
from typing import Any, ClassVar, Protocol, Self, runtime_checkable

import yaml

from gain.genomic_resources.repository import (
    GR_CONF_FILE_NAME,
    GenomicResource,
    GenomicResourceProtocolRepo,
)
from gain.genomic_resources.resource_types import (
    require_fragment_score_type,
)
from gain.genomic_resources.testing import (
    build_filesystem_test_repository,
    build_inmemory_test_resource,
    convert_to_tab_separated,
    setup_bigwig,
    setup_directories,
    setup_genome,
    setup_genome_bgz,
    setup_tabix,
    setup_vcf,
)
from gain.genomic_resources.testing.resource_meta import (
    MetaMixin,
    append_config_block,
)
from gain.genomic_resources.testing.score_specs import (
    ResourceValidationError,
    ScoreSpec,
    append_score,
    render_score_specs_yaml,
    scores_or_default,
    set_aggregator,
    set_histogram,
    set_na_values,
)


[docs] @runtime_checkable class ResourceBuilder(Protocol): """Structural interface for a single-resource test builder. Every resource builder knows how to realize exactly one resource -- its config plus data/index files -- into a directory. ``GRRBuilder`` composes heterogeneous builders through this one seam; each implementation delegates to the appropriate ``setup_*`` helper from :mod:`gain.genomic_resources.testing`. """
[docs] def realize_into(self, resource_dir: pathlib.Path) -> None: """Write this resource's directory into ``resource_dir``.""" ...
_DATA_FILENAME = "data.txt" # ``build_definition`` writes the GRR definition alongside, not inside, the # directory it points at. Public because the sibling group builder writes # the same layout, and one definition of it is what keeps the two agreeing. GRR_DEFINITION_FILENAME = "grr.yaml" GRR_RESOURCES_DIRNAME = "grr" #: Repository id a ``build_definition`` writes when a test names none. _DEFAULT_GRR_ID = "test_grr"
[docs] def write_grr_definition( root: pathlib.Path, definition: dict[str, Any], ) -> pathlib.Path: """Write ``definition`` as ``root/grr.yaml`` and return its path. Shared by the GRR and group builders so the serialization policy and the "definition sits OUTSIDE the directory it points at" rule are stated once. A stray ``grr.yaml`` among the resources would be walked as though it were one. """ definition_path = root / GRR_DEFINITION_FILENAME setup_directories(definition_path, yaml.safe_dump( definition, default_flow_style=False, sort_keys=False)) return definition_path
# The tabix table filename used when a table score is realized as tabix # (``.txt.gz`` + ``.tbi``) instead of the plain ``.txt`` default. _TABIX_FILENAME = "data.txt.gz" _CHROM_MAPPING_FILENAME = "chrom_map.txt" # The ``header_mode`` values a table score may declare. ``"file"`` is the # backend default and the builder's default realize path: the authored header # line is written into the data file and read back from it. ``"none"`` and # ``"list"`` both realize a HEADERLESS data file and describe the columns in # the config instead. _HEADER_MODES = ("file", "none", "list") @dataclasses.dataclass(frozen=True) class _TableScoreBuilder(MetaMixin): """Immutable base for the tabular position/allele score builders. The three table-score resource types share nearly everything: score declaration (:class:`ScoreSpec`), header validation, YAML rendering, the ``with_data`` / typed ``with_score_line`` authoring modes and the plain-``.txt`` / tabix realize paths. They differ only in a handful of class-level knobs supplied by each subclass: * ``SCORE_TYPE`` -- the ``type:`` config value. * ``TRAILING_COLUMNS`` -- extra required base columns after the position columns (``reference``/``alternative`` for an allele score; none for position). * ``TABLE_EXTRA_CONFIG`` -- extra lines spliced into the ``table:`` block (the ``reference``/``alternative`` name mapping for an allele score). Under ``header_mode: none`` there is no header for a name to match, so those base columns are rendered by index instead -- see :meth:`with_header_mode`. * ``DEFAULT_DATA`` -- the bare-builder default data block. """ scores: tuple[ScoreSpec, ...] = () data: str | None = None rows: tuple[tuple[tuple[str, str], ...], ...] = () tabix: bool = False csi: bool = False # only meaningful with ``tabix`` # The index name to declare as ``index_filename:`` in the table config # and realize under -- conventional or not; only meaningful with # ``tabix``. index_filename: str | None = None # Leaves a copy of the index at its conventional name too; REQUIRES an # ``index_filename`` that is not itself the conventional name, since it # is the SECOND name that makes two indices possible. keep_conventional_index: bool = False chrom_mapping: dict[str, Any] | None = None # The ``chrom -> file_chrom`` rows of a mapping FILE, realized beside # the data as ``_CHROM_MAPPING_FILENAME``; see # :meth:`with_chrom_mapping_file`. chrom_mapping_rows: tuple[tuple[str, str], ...] | None = None zero_based: bool = False header_mode: str | None = None # Suppresses the ``header_mode:`` key while keeping everything else the # ``"none"`` mode realizes -- see :meth:`with_missing_header_mode`. omit_header_mode: bool = False # Overrides ``SCORE_TYPE``; see # :meth:`FragmentScoreBuilder.with_resource_type`. resource_type: str | None = None # Trailing key columns to leave OUT of the table entirely; see # :meth:`without_key_columns`. dropped_key_columns: frozenset[str] = frozenset() # Subclass-provided knobs. SCORE_TYPE: ClassVar[str] = "" LEADING_COLUMNS: ClassVar[tuple[str, ...]] = ("chrom", "pos_begin") TRAILING_COLUMNS: ClassVar[tuple[str, ...]] = () # ``pos_end`` is an allowed optional column for EVERY table score type, # the allele score included: it realizes onto the same # genomic_position_table # backend, which derives ``pos_end_key`` from the header and range-matches # a query position inside a record's [pos_begin, pos_end] span. Shared, # not position-only -- so it stays on the base and is inherited. OPTIONAL_COLUMNS: ClassVar[tuple[str, ...]] = ("pos_end",) TABLE_EXTRA_CONFIG: ClassVar[str] = "" DEFAULT_DATA: ClassVar[str] = "" def with_score( self, score_id: str, value_type: str, *, column_name: str | None = None, column_index: int | None = None, desc: str | None = None, ) -> Self: """Declare a score once; ``column_name`` defaults to ``score_id``. Pass ``column_index`` instead to address the column by its 0-based position in the data header. The two modes are mutually exclusive. Index addressing requires :meth:`with_data`; the typed :meth:`with_score_line` synthesizes the header from the declared column names and so has no position to point at. """ return dataclasses.replace( self, scores=append_score( self.scores, score_id, value_type, column_name=column_name, column_index=column_index, desc=desc), ) def without_key_columns(self, *columns: str) -> Self: """Build the table WITHOUT these trailing key columns. ``reference`` and ``alternative`` are independently optional in the allele-score schema, and a resource declaring neither -- or only one -- is a legal shape a reader has to answer for. A bare :func:`an_allele_score` always renders both, so this is how a test reaches the shapes it otherwise cannot express. The dropped column disappears from the required data header, from the rendered ``table:`` block and from the index-addressed column mappings alike, so the resource is consistent rather than merely missing a config line. Supply :meth:`with_data` to match: the default data block carries the columns this removes. Accumulates, so two calls drop two columns rather than the second forgetting the first. """ unknown = set(columns) - set(self.TRAILING_COLUMNS) if unknown: raise ResourceValidationError( f"without_key_columns: {sorted(unknown)} are not key columns " f"of a {self.SCORE_TYPE}; it has " f"{list(self.TRAILING_COLUMNS)}") return dataclasses.replace( self, dropped_key_columns=self.dropped_key_columns | set(columns)) @property def _effective_trailing_columns(self) -> tuple[str, ...]: """``TRAILING_COLUMNS`` less whatever was dropped.""" return tuple( column for column in self.TRAILING_COLUMNS if column not in self.dropped_key_columns) def _effective_table_extra_config(self) -> str: """The ``table:`` extra block for the columns still present. Byte-identical to the ``TABLE_EXTRA_CONFIG`` knob while nothing is dropped -- the derived path exists only for the shapes :meth:`without_key_columns` reaches. """ if not self.dropped_key_columns: return self.TABLE_EXTRA_CONFIG return "".join( f" {column}:\n name: {column}\n" for column in self._effective_trailing_columns) def with_chrom_mapping(self, **mapping: Any) -> Self: """Emit a ``chrom_mapping:`` block in the ``table:`` config. Keys are passed through verbatim, e.g. ``with_chrom_mapping(add_prefix="chr")``. For a mapping shipped as a FILE use :meth:`with_chrom_mapping_file`, which writes it too. """ return dataclasses.replace(self, chrom_mapping=dict(mapping)) def with_chrom_mapping_file(self, **file_chrom_by_chrom: str) -> Self: """Ship a ``chrom -> file_chrom`` mapping file the config points at. ``with_chrom_mapping_file(kept="chr1", empty="chr99")`` realizes a two-column ``chrom\\tfile_chrom`` file beside the data and emits ``chrom_mapping: {filename: ...}`` for it. A chromosome mapped onto a file contig the data does not carry is the way to author a listed-but-empty contig -- the shape the in-memory backend answers ``ContigExtent.EMPTY`` for (gain#509). """ return dataclasses.replace( self, chrom_mapping={"filename": _CHROM_MAPPING_FILENAME}, chrom_mapping_rows=tuple(file_chrom_by_chrom.items())) def with_zero_based(self) -> Self: """Emit ``zero_based: true`` in the ``table:`` config. Declares the authored positions as 0-based half-open intervals, the convention a ``.bed``-style source uses. The backend shifts a record's ``pos_begin`` up by one on read (and a single-base record's ``pos_end`` with it), so a row authored at ``pos_begin`` is queried at ``pos_begin + 1``. Applies to both the plain ``.txt`` and the tabix realize paths. """ return dataclasses.replace(self, zero_based=True) def with_header_mode(self, header_mode: str) -> Self: """Declare how the table's column names are described. ``"file"`` -- the backend default and the builder's default -- keeps the authored header line in the realized data file (as a ``#`` comment on the tabix path) and lets the backend read the columns from it. ``"none"`` and ``"list"`` realize a HEADERLESS data file: the file carries data rows only, and the config describes the columns instead -- explicit ``column_index:`` mappings for ``"none"``, a ``header:`` list for ``"list"``. This is one of the knobs that reintroduces a SECOND description of the columns, which is what the builders otherwise exist to prevent (see the module docstring of :mod:`.builders` and gain#318). It is kept honest by deriving everything from ONE declaration: the header line authored in :meth:`with_data` stays the single source, feeding the rendered config's column indices, the tabix ``seq_col``/``start_col``/``end_col``, and the header validation -- even in the modes where it is not written into the file. With ``"none"`` there is no header to resolve a name against, so every declared score must address its column by ``column_index`` (:meth:`with_score`); a name-addressed score is rejected at realize time rather than left to fail inside the score implementation. """ if header_mode not in _HEADER_MODES: raise ResourceValidationError( f"unsupported header_mode {header_mode!r}; " f"expected one of {list(_HEADER_MODES)}") return dataclasses.replace( self, header_mode=header_mode, omit_header_mode=False) def with_missing_header_mode(self) -> Self: """Realize the misconfiguration behind gain#364. Everything ``with_header_mode("none")`` realizes -- a headerless data file with index-addressed columns -- except the ``header_mode:`` key itself, which the config forgets. The backend therefore falls back to its ``"file"`` default and looks for a header the file does not have. The resulting resource does NOT open; it exists so a test can watch that failure be reported. Do not reach for it to build a working headerless resource -- that is :meth:`with_header_mode`. """ return dataclasses.replace( self, header_mode="none", omit_header_mode=True) def with_histogram( self, histogram: dict[str, Any], *, score_id: str | None = None, ) -> Self: """Attach a histogram block to a declared score. With ``score_id`` omitted the histogram is attached to the most-recently-declared score; passing ``score_id`` targets that score. The block is emitted verbatim under ``histogram:`` in the resource config. """ return dataclasses.replace( self, scores=set_histogram( self.scores, histogram, score_id=score_id), ) def with_na_values( self, na_values: str | list[str], *, score_id: str | None = None, ) -> Self: """Declare the NA sentinel(s) for a score. With ``score_id`` omitted the sentinel(s) are attached to the most-recently-declared score; passing ``score_id`` targets that score. Accepts either a scalar (``"-1"``) or a list (``["-1", "-999"]``), emitted verbatim under ``na_values:`` -- the resource schema permits both forms. """ return dataclasses.replace( self, scores=set_na_values( self.scores, na_values, score_id=score_id), ) def with_aggregator( self, aggregator: str, *, score_id: str | None = None, ) -> Self: """Declare the score's default aggregator. Emitted under ``aggregator:`` -- the resource-level default a pipeline uses when an attribute does not name one of its own. A score has one aggregator; which reduction it names is fixed by the resource type (over a region of positions, over the alleles at one, over overlapping fragments), so there is nothing to choose between here. With ``score_id`` omitted it attaches to the most-recently-declared score. The value is rendered verbatim, so an invalid one can be authored on purpose to watch the resource schema reject it. """ return dataclasses.replace( self, scores=set_aggregator( self.scores, aggregator, score_id=score_id), ) def with_data(self, data: str) -> Self: """Author the score table as a whitespace-separated block. The block is validated at the header level only: it must contain at least the declared columns (required position columns plus each score's ``column_name``). Row-level completeness is not checked, so a header-only block validates and realizes -- reading it back then surfaces a lower-level score error, not a builder one. Mutually exclusive with :meth:`with_score_line`; setting both raises ``ResourceValidationError`` when the resource is realized. """ return dataclasses.replace(self, data=data) def with_score_line(self, **columns: Any) -> Self: """Append one typed data row; multiple calls accumulate. A typed alternative to the free-form :meth:`with_data` string: each call contributes one row as ``column=value`` keyword pairs (position columns plus each declared score's ``column_name``). The builder synthesizes the SAME table -- header from the declared columns, rows from the accumulated calls -- that the equivalent ``with_data`` string would produce, so both authoring modes read back identically. Each value is stringified via ``str(value)`` to form the cell text, so pass values whose ``str()`` is the intended cell content (e.g. avoid relying on float ``repr`` for exotic values). Mutually exclusive with :meth:`with_data`. """ row = tuple((str(key), str(value)) for key, value in columns.items()) return dataclasses.replace(self, rows=(*self.rows, row)) def with_tabix( self, *, csi: bool = False, index_filename: str | None = None, keep_conventional_index: bool = False, ) -> Self: """Realize the score table as tabix (``.txt.gz`` + ``.tbi``). The default is a plain ``.txt`` table; ``with_tabix`` switches the realize path to :func:`setup_tabix` and points ``table.filename`` at the ``.txt.gz`` with ``format: tabix``. The resource reads back identically to the plain form. With ``csi=True`` the index is a ``.csi`` -- the flavour a contig beyond tabix's ~512 Mbp limit requires -- rather than the default ``.tbi``. ``index_filename`` realizes the index under a name of the caller's choosing and declares it as ``index_filename:`` in the table config, instead of leaving it at the conventional ``<data-filename>.tbi`` / ``.csi``. Pass a NON-adjacent name (e.g. ``data.custom.tbi``) whenever the test is about index resolution: on a local filesystem htslib auto-probes for an adjacent index, so an index left at its conventional name proves nothing about which name the code resolved. ``keep_conventional_index`` additionally leaves a copy of the index at the conventional name, so the resource carries BOTH. That is the shape that tells "the configured name wins" apart from "the conventional probe happened to find the only index there was". It REQUIRES a SECOND name to realize the configured index under, so it is rejected both without an ``index_filename`` and with one that names the conventional index itself -- neither can carry two indices, and quietly realizing one instead is what makes a test assert the two-index shape while exercising the one-index shape. An ``index_filename`` that IS the conventional name, without the flag, is accepted and yields that single index. Precondition: the authored rows (via :meth:`with_data` or :meth:`with_score_line`) must be position-sorted -- ascending by chrom then pos_begin -- when ``with_tabix`` is used, because ``pysam.tabix_index`` requires sorted input and otherwise fails loudly with an ``OSError`` un-annotated by the resource id. """ return dataclasses.replace( self, tabix=True, csi=csi, index_filename=index_filename, keep_conventional_index=keep_conventional_index) def realize_into(self, resource_dir: pathlib.Path) -> None: """Write this table-score resource into ``resource_dir``. Raises a ``ResourceValidationError`` on invalid content; ``GRRBuilder`` annotates it with the resource id. """ scores = scores_or_default(self.scores) data = self._effective_data(scores) _validate_score_specs(scores) _validate_data_header( data, scores, base_required=( self.LEADING_COLUMNS + self._effective_trailing_columns), base_optional=self.OPTIONAL_COLUMNS) self._validate_header_mode(scores) self._validate_index_options() # The authored header is the single column declaration; the modes # that do not write it into the file still resolve their indices # from it. write_header = self._effective_header_mode() == "file" sidecars = self._render_chrom_mapping_file() if self.tabix: setup_directories(resource_dir, { GR_CONF_FILE_NAME: self._render_config( scores, _TABIX_FILENAME, data), **sidecars, }) _realize_tabix_table( resource_dir / _TABIX_FILENAME, data, write_header=write_header, csi=self.csi, index_filename=self.index_filename, keep_conventional_index=self.keep_conventional_index) else: file_data = data if write_header else _strip_header(data) setup_directories(resource_dir, { GR_CONF_FILE_NAME: self._render_config( scores, _DATA_FILENAME, data), _DATA_FILENAME: convert_to_tab_separated(file_data), **sidecars, }) def _render_chrom_mapping_file(self) -> dict[str, str]: """The mapping file :meth:`with_chrom_mapping_file` ships, if any.""" if self.chrom_mapping_rows is None: return {} lines = ["chrom\tfile_chrom"] lines.extend( f"{chrom}\t{file_chrom}" for chrom, file_chrom in self.chrom_mapping_rows) return {_CHROM_MAPPING_FILENAME: "\n".join(lines) + "\n"} def _effective_header_mode(self) -> str: """Return the header mode the realized DATA is authored for. ``with_missing_header_mode`` realizes the data of the ``"none"`` mode without the config key that declares it, so this is not the mode the config states -- it is the one the file is written in. """ return self.header_mode or "file" def _validate_header_mode(self, scores: tuple[ScoreSpec, ...]) -> None: """Reject a score addressing a column that will not be resolvable.""" if self._effective_header_mode() != "none": return named = [ spec.score_id for spec in scores if spec.column_index is None ] if named: raise ResourceValidationError( f"header_mode 'none' leaves no header to resolve a column " f"name against; score(s) {sorted(named)} must be declared " f"with column_index") def _validate_index_options(self) -> None: """Reject a keep-the-conventional-index request with no second name. ``keep_conventional_index`` asks for BOTH index names to be present, which needs a second name -- ``index_filename`` -- to realize the configured index under. Alone the flag has nowhere to put that second index, so honouring it would silently realize the one-index shape and leave a test asserting the two-index shape passing for the wrong reason. The companion case -- an ``index_filename`` that names the conventional index itself, which is a name but not a second one -- is caught during realize, where the name pysam actually wrote is known and the two can be compared by identity rather than spelling. """ if self.keep_conventional_index and self.index_filename is None: raise ResourceValidationError( "keep_conventional_index asks for the index at BOTH the " "configured and the conventional name, so it requires an " "index_filename to realize the configured one under; " "pass index_filename= or drop the flag") def build_resource( self, tmp_path: pathlib.Path, ) -> GenomicResource: """Realize this single resource (repo id ``""``) into ``tmp_path``. Delegates to the GRR builder so there is a single realize path. """ return _build_single_resource(self, tmp_path) def _effective_data(self, scores: tuple[ScoreSpec, ...]) -> str: if self.data is not None and self.rows: raise ResourceValidationError( "with_data and with_score_line are mutually exclusive; " "author the table with only one of them") if self.data is not None: return self.data if self.rows: return self._synthesize_rows(scores) return self.DEFAULT_DATA def _synthesize_rows(self, scores: tuple[ScoreSpec, ...]) -> str: """Render the accumulated typed rows as a whitespace data block.""" indexed = [s.score_id for s in scores if s.column_index is not None] if indexed: raise ResourceValidationError( f"score(s) {sorted(indexed)} address a column by " f"column_index, which needs an authored header; use " f"with_data instead of with_score_line") row_dicts = [dict(row) for row in self.rows] uses_pos_end = any("pos_end" in rd for rd in row_dicts) if uses_pos_end and not all("pos_end" in rd for rd in row_dicts): raise ResourceValidationError( "with_score_line: 'pos_end' must be given on every row " "or on none") header = list(self.LEADING_COLUMNS) if uses_pos_end: header.append("pos_end") header.extend(self._effective_trailing_columns) header.extend( spec.column_name for spec in scores if spec.column_name is not None ) lines = [" ".join(header)] header_set = set(header) for rd in row_dicts: missing = header_set - set(rd) if missing: raise ResourceValidationError( f"with_score_line row is missing column(s) " f"{sorted(missing)}; expected {header}") extra = set(rd) - header_set if extra: raise ResourceValidationError( f"with_score_line row has unexpected column(s) " f"{sorted(extra)}; expected {header}") lines.append(" ".join(rd[col] for col in header)) return "\n".join(lines) + "\n" def _render_config( self, scores: tuple[ScoreSpec, ...], filename: str, data: str, ) -> str: header = _parse_header(data) lines = [ f"type: {self.resource_type or self.SCORE_TYPE}", "table:", f" filename: {filename}", ] if self.tabix: lines.append(" format: tabix") if self.index_filename is not None: lines.append(f" index_filename: {self.index_filename}") if self.header_mode is not None and not self.omit_header_mode: lines.append(f" header_mode: {self.header_mode}") if self.header_mode == "list": lines.append(" header:") lines.extend(f" - {column}" for column in header) if self.zero_based: lines.append(" zero_based: true") if self.chrom_mapping is not None: lines.append(" chrom_mapping:") mapping_yaml = yaml.safe_dump( self.chrom_mapping, default_flow_style=False, sort_keys=False) lines.extend( f" {mapping_line}" for mapping_line in mapping_yaml.rstrip("\n").split("\n") ) config = "\n".join(lines) + "\n" if self._effective_header_mode() == "none": # No header to match a column name against, so the base columns # are addressed by index -- resolved from the same authored # header the tabix index columns come from. config += self._render_column_indexes(header) else: config += self._effective_table_extra_config() config += "scores:\n" + render_score_specs_yaml(scores) return config + self.render_meta() def _render_column_indexes(self, header: list[str]) -> str: """Render the base columns as explicit ``column_index:`` mappings.""" columns = [ *self.LEADING_COLUMNS, *(column for column in self.OPTIONAL_COLUMNS if column in header), *self._effective_trailing_columns, ] lines: list[str] = [] for column in columns: lines.extend(( f" {column}:", f" column_index: {header.index(column)}", )) return "\n".join(lines) + "\n"
[docs] @dataclasses.dataclass(frozen=True) class PositionScoreBuilder(_TableScoreBuilder): """Immutable builder for a single ``position_score`` resource.""" SCORE_TYPE: ClassVar[str] = "position_score" DEFAULT_DATA: ClassVar[str] = """ chrom pos_begin score 1 10 0.1 1 11 0.2 1 15 0.3 """
# The ``reference``/``alternative`` column mapping spliced into the ``table:`` # block of an allele score config; it locates its ref/alt columns # by name (matching the ``reference``/``alternative`` data columns). _REF_ALT_TABLE_CONFIG = ( " reference:\n" " name: reference\n" " alternative:\n" " name: alternative\n" ) # allele default data: chrom/pos_begin plus the ref/alt columns and one # default float score. _ALLELE_DEFAULT_DATA = """ chrom pos_begin reference alternative score 1 10 A G 0.1 1 10 A C 0.2 1 16 C T 0.3 """
[docs] @dataclasses.dataclass(frozen=True) class AlleleScoreBuilder(_TableScoreBuilder): """Immutable builder for a single ``allele_score`` resource. Requires ``reference``/``alternative`` columns and reads back through ``AlleleScore``. Had a twin, ``NPScoreBuilder``, differing only in emitting ``type: np_score``. It was retired with the type itself in 2026.8.5 (gain#920): a builder can only produce resources GAIn still reads. Its fixtures moved here unchanged apart from the type. None needed ``allele_score_mode: substitutions`` to keep behaving the same, even though the mode default differs between the two spellings -- nothing in gain reads ``AlleleScore.mode`` outside ``substitutions_mode()`` and ``alleles_mode()``, and no migrated fixture consults either. The mode hazard the removal warns about is real for a GRR holder whose own code asks; it was inert in this suite. """ SCORE_TYPE: ClassVar[str] = "allele_score" TRAILING_COLUMNS: ClassVar[tuple[str, ...]] = ("reference", "alternative") TABLE_EXTRA_CONFIG: ClassVar[str] = _REF_ALT_TABLE_CONFIG DEFAULT_DATA: ClassVar[str] = _ALLELE_DEFAULT_DATA
[docs] @dataclasses.dataclass(frozen=True) class FragmentScoreBuilder(_TableScoreBuilder): """Immutable builder for a single fragment score resource. Shares the tabular-score machinery with the position/allele builders, differing only in the type value. A fragment is a region rather than a point, so the default data carries the optional ``pos_end`` column. Reads back through ``FragmentScore``, which weights every record 1 however long it is. """ SCORE_TYPE: ClassVar[str] = "fragment_score" DEFAULT_DATA: ClassVar[str] = """ chrom pos_begin pos_end score 1 10 19 0.1 1 20 200 0.2 """
[docs] def with_resource_type(self, resource_type: str) -> Self: """Render ``fragment_score`` or ``cnv_collection`` as the ``type:``. A bare builder already renders ``fragment_score``, the preferred spelling; reach for this to pin the legacy ``cnv_collection``. Raises if ``resource_type`` names no fragment score. Only a fragment score has two spellings, hence not on the base. """ return dataclasses.replace( self, resource_type=require_fragment_score_type(resource_type))
_BIGWIG_FILENAME = "data.bw" _BIGWIG_DEFAULT_DATA = """ chr1 0 10 0.1 chr1 10 20 0.2 chr2 0 30 0.3 """ _BIGWIG_DEFAULT_CHROM_LENS = {"chr1": 1000, "chr2": 1000} def _normalize_bedgraph(data: str) -> str: """Strip blank and whitespace-only lines from a bedGraph block. ``setup_bigwig`` splits on newlines and asserts four columns on every line, so a whitespace-only line -- exactly what an indented closing triple-quote leaves behind -- trips a bare ``AssertionError`` naming neither the builder nor the row. Authoring a block with the closing quote indented is the normal case for the other builders, so normalize here rather than make indentation significant for this one. """ return "\n".join( stripped for line in data.split("\n") if (stripped := line.strip()) )
[docs] @dataclasses.dataclass(frozen=True) class BigWigScoreBuilder(MetaMixin): """Immutable builder for a bigWig-backed ``position_score``. Authored as bedGraph rows (``chrom start end value``), whose intervals are 0-based half-open -- 1-based position ``p`` reads the interval containing ``p - 1``. Unlike the tabular builders this one declares exactly one score, because a bigWig carries a single value -- and a resource declaring more than one is refused at open (``bigwig_scores.validate_bigwig_scoredefs``). **The emitted score block addresses no column**, which is the canonical bigWig config: a bigWig record's payload IS its value, so there is nothing to address. An ``index:`` key is a deprecated no-op, accepted with a warning for the deployed resources that carry it; a test that wants that path authors it as yaml -- see ``test_bigwig_scores.py``. """ score_id: str = "score" value_type: str = "float" filename: str | None = None table_format: str | None = None data: str | None = None chrom_lens: dict[str, int] | None = None histogram: dict[str, Any] | None = None na_values: str | list[str] | None = None fetch_budgets: dict[str, int] | None = None zero_based: bool = False resource_type: str | None = None
[docs] def with_resource_type(self, resource_type: str) -> Self: """Render a ``type:`` other than ``position_score``. The backend a resource gets is chosen by its table FORMAT, not by its type (``build_genomic_position_table``), so a bigWig can sit under an ``allele_score`` just as well as under a ``position_score``. Nobody publishes one -- a bigWig has no reference or alternative to carry -- and that is precisely what makes it worth building: it is how a test reaches an allele score whose backend serves column arrays and whose table has no key columns at all. Restricted to the types that read back through a score class over this backend; ``fragment_score`` is not among them, since a bigWig record is a point value rather than an attributed interval. """ allowed = ("position_score", "allele_score") if resource_type not in allowed: raise ResourceValidationError( f"with_resource_type: {resource_type!r} is not a score type " f"a bigWig backs; expected one of {list(allowed)}") return dataclasses.replace(self, resource_type=resource_type)
[docs] def with_fetch_size(self, fetch_size: int) -> Self: """Emit ``fetch_size:`` in the ``table:`` config. A budget in *records per range query*, not base pairs. The only fetch knob offered: this builder is ours rather than config surface, so it offers no key that does nothing (see ``docs/adr/0002-remove-bigwig-fetch-buffering.md``). """ return dataclasses.replace( self, fetch_budgets={"fetch_size": fetch_size})
[docs] def with_score(self, score_id: str, value_type: str = "float") -> Self: """Name the single score this bigWig exposes.""" return dataclasses.replace( self, score_id=score_id, value_type=value_type)
[docs] def with_format(self, table_format: str) -> Self: """Emit an explicit ``format:`` in the ``table:`` config. The key the suffix only supplies a default for. Authoring it makes a test able to state the precedence between the two inputs -- pairing it with a :meth:`with_filename` whose suffix maps elsewhere is the only way to observe that the explicit key wins (gain#348). Emitted verbatim, so a test can also author the case variants the dispatch accepts. """ return dataclasses.replace(self, table_format=table_format)
[docs] def with_filename(self, filename: str) -> Self: """Name the bigWig file, overriding the default ``data.bw``. The suffix is not decoration: with no ``format:`` key it is the whole input to the backend decision (``build_genomic_position_table``), so a test about that decision has to author it. Any name is accepted, including one whose suffix maps elsewhere -- proving that an explicit ``format:`` overrides the suffix needs exactly such a resource. The bigWig payload itself is written by ``pyBigWig``, which reads the handle rather than the name (gain#348). """ return dataclasses.replace(self, filename=filename)
[docs] def with_na_values(self, na_values: str | list[str]) -> Self: """Declare the NA sentinel(s) for the single bigWig score. A bigWig exposes exactly one score, so no ``score_id`` is needed. Accepts either a scalar (``"-1"``) or a list, emitted verbatim under ``na_values:`` in the resource config -- the schema permits both. """ if isinstance(na_values, list): na_values = list(na_values) return dataclasses.replace(self, na_values=na_values)
[docs] def with_histogram(self, histogram: dict[str, Any]) -> Self: """Attach a histogram block to the single bigWig score. A bigWig exposes exactly one score, so no ``score_id`` is needed. The block is emitted verbatim under ``histogram:`` in the resource config; without it a numeric bigWig score relies on the resource's auto-built default histogram. """ # Defensive copy so a caller mutating their dict afterward cannot # leak into this immutable builder. return dataclasses.replace(self, histogram=copy.deepcopy(histogram))
[docs] def with_data(self, data: str) -> Self: """Author the bedGraph rows as a whitespace-separated block.""" return dataclasses.replace(self, data=data)
[docs] def with_chrom_lens(self, chrom_lens: dict[str, int]) -> Self: """Declare the chromosome lengths written into the bigWig header.""" return dataclasses.replace(self, chrom_lens=dict(chrom_lens))
[docs] def with_zero_based(self) -> Self: """Emit ``zero_based: true`` in the ``table:`` config. A bigWig hard-codes its 0-based-half-open to closed-1-based conversion and never consults the key -- authoring it here realizes, config-first, the misconfiguration the table-build warning is meant to surface, and lets a test carry the key through schema validation instead of injecting it into a table dict by hand. """ return dataclasses.replace(self, zero_based=True)
[docs] def realize_into(self, resource_dir: pathlib.Path) -> None: """Write the resource config and the bigWig into ``resource_dir``.""" data = self.data if self.data is not None else _BIGWIG_DEFAULT_DATA chrom_lens = ( self.chrom_lens if self.chrom_lens is not None else _BIGWIG_DEFAULT_CHROM_LENS ) data = _normalize_bedgraph(data) self._validate(data, chrom_lens) setup_directories( resource_dir, {GR_CONF_FILE_NAME: self._render_config()}) setup_bigwig( resource_dir / (self.filename or _BIGWIG_FILENAME), data, chrom_lens)
[docs] def build_resource(self, tmp_path: pathlib.Path) -> GenomicResource: """Realize this single resource (repo id ``""``) into ``tmp_path``.""" return _build_single_resource(self, tmp_path)
@staticmethod def _validate(data: str, chrom_lens: dict[str, int]) -> None: """Reject a bedGraph block the bigWig writer would reject opaquely. ``setup_bigwig`` asserts on arity and ``pyBigWig`` raises on an unheadered contig; both surface without naming the builder or the offending row, so check here where the row is still in hand. """ for line in data.split("\n"): stripped = line.strip() if not stripped: continue tokens = stripped.split() if len(tokens) != 4: raise ResourceValidationError( f"bedGraph row must have 4 columns " f"(chrom start end value), got {len(tokens)}: " f"{stripped!r}") if tokens[0] not in chrom_lens: raise ResourceValidationError( f"bedGraph row on contig {tokens[0]!r} which has no " f"declared length; call with_chrom_lens for it") def _render_config(self) -> str: budget_lines = "".join( f" {key}: {value}\n" for key, value in (self.fetch_budgets or {}).items() ) zero_based_line = ( " zero_based: true\n" if self.zero_based else "") format_line = ( f" format: {self.table_format}\n" if self.table_format is not None else "") config = ( f"type: {self.resource_type or 'position_score'}\n" "table:\n" f" filename: {self.filename or _BIGWIG_FILENAME}\n" f"{format_line}" f"{zero_based_line}" f"{budget_lines}" "scores:\n" f"- id: {self.score_id}\n" f" type: {self.value_type}\n" ) if self.na_values is not None: na_yaml = yaml.safe_dump( {"na_values": self.na_values}, default_flow_style=False, sort_keys=False) config += "".join( f" {na_line}\n" for na_line in na_yaml.rstrip("\n").split("\n") ) if self.histogram is not None: config += " histogram:\n" hist_yaml = yaml.safe_dump( self.histogram, default_flow_style=False, sort_keys=False) config += "".join( f" {hist_line}\n" for hist_line in hist_yaml.rstrip("\n").split("\n") ) return config + self.render_meta()
_VCF_FILENAME = "data.vcf.gz" # ``setup_vcf`` derives the header sidecar from the data filename and indexes # it alongside; ``without_header_index`` drops that index again. _VCF_HEADER_INDEX_FILENAME = "data.header.vcf.gz.tbi" _VCF_DEFAULT_DATA = """ ##fileformat=VCFv4.1 ##INFO=<ID=score,Number=1,Type=Float,Description="a float"> #CHROM POS ID REF ALT QUAL FILTER INFO chr1 10 . A T . . score=0.1 chr1 11 . A T . . score=0.2 """
[docs] @dataclasses.dataclass(frozen=True) class VcfInfoScoreBuilder(MetaMixin): """Immutable builder for a VCF-backed ``allele_score`` resource. The score definitions are derived by the resource from the VCF's ``##INFO`` header, so a bare builder declares none: author the INFO metadata in the VCF text and the scores follow. :meth:`with_score` AMENDS one of them through a ``scores:`` entry -- the ``desc``, ``na_values``, ``aggregator`` and ``histogram`` a config may give a header-derived score, and a ``type:`` where the header declares a scalar (dbSNP's ``Flag`` typed ``bool`` is the canonical case). Its ``value_type`` defaults to ``None``, an entry that states no ``type:`` at all, because that is a first-class shape here (gain#1221) and the header already carries one. The block is a FILTER by default -- the resource defines only the fields it names; :meth:`with_merge_vcf_scores` turns it into an override, merging every unnamed header field back in. Nothing declared is checked against the VCF text: an entry naming no INFO field, or stating a type the header's ``Number`` denies, is what a test authors to watch the RESOURCE refuse it (gain#1336), so the builder renders it as given. The block itself is checked as the table builders check theirs -- a field declared twice is refused at realize. Reads back through ``AlleleScore`` on the ``vcf_info`` table backend, which the ``.vcf.gz`` filename selects. """ data: str | None = None scores: tuple[ScoreSpec, ...] = () merge_vcf_scores: bool = False zero_based: bool = False csi: bool = False index_filename: str | None = None realize_index_filename: bool = True header_index: bool = True
[docs] def with_data(self, data: str) -> Self: """Author the whole VCF, ``##`` header lines included.""" return dataclasses.replace(self, data=data)
[docs] def with_score( self, score_id: str, value_type: str | None = None, *, desc: str | None = None, ) -> Self: """Amend the INFO field ``score_id`` through a ``scores:`` entry. With no ``value_type`` the entry states no ``type:`` and reads what the header-only resource reads (gain#1221). """ return dataclasses.replace( self, scores=append_score(self.scores, score_id, value_type, desc=desc), )
[docs] def with_histogram( self, histogram: dict[str, Any], *, score_id: str | None = None, ) -> Self: """Attach a histogram block to a score declared with_score.""" return dataclasses.replace( self, scores=set_histogram(self.scores, histogram, score_id=score_id), )
[docs] def with_na_values( self, na_values: str | list[str], *, score_id: str | None = None, ) -> Self: """Declare the NA sentinel(s) of a score declared with_score.""" return dataclasses.replace( self, scores=set_na_values(self.scores, na_values, score_id=score_id), )
[docs] def with_aggregator( self, aggregator: str, *, score_id: str | None = None, ) -> Self: """Declare the default aggregator of a score declared with_score.""" return dataclasses.replace( self, scores=set_aggregator(self.scores, aggregator, score_id=score_id), )
[docs] def with_csi_index(self) -> Self: """Index the bgzipped VCF as ``.csi``, not the default ``.tbi``.""" return dataclasses.replace(self, csi=True)
[docs] def with_index_filename(self, index_filename: str) -> Self: """Realize the index at ``index_filename`` and declare it in config. The index htslib writes next to the data file is MOVED to ``index_filename`` -- so no adjacent ``data.vcf.gz.tbi`` / ``data.vcf.gz.csi`` is left behind -- and the table config declares ``index_filename:`` pointing at it. Moving it is the whole point: htslib auto-probes for an adjacent index and opens happily without being told about it, so a resource whose index sits at its default name proves nothing about whether the configured ``index_filename`` was honoured (gain#596). """ return dataclasses.replace( self, index_filename=index_filename, realize_index_filename=True)
[docs] def with_missing_index_filename(self, index_filename: str) -> Self: """Declare ``index_filename:`` in the config with no such file. The realized index stays at its default adjacent name, so htslib could still auto-probe its way to a working file -- which is exactly what an open must NOT do here: an explicitly configured index that does not exist has to fail, naming the configured path rather than quietly reading through some other one (gain#596). """ return dataclasses.replace( self, index_filename=index_filename, realize_index_filename=False)
[docs] def without_header_index(self) -> Self: """Ship the ``*.header.vcf.gz`` sidecar with no index of its own. The realize path indexes the sidecar because it bgzips it the same way as the data file; real score resources (dbSNP is the canonical one) ship it unindexed. Use this to realize that shape: the table reads its INFO metadata without an index, and opened by name it is a file whose index resolution resolves to NOTHING and must still open (gain#596). """ return dataclasses.replace(self, header_index=False)
[docs] def with_zero_based(self) -> Self: """Emit ``zero_based: true`` in the ``table:`` config. A VCF is always 1-based, so the ``vcf_info`` backend ignores the key -- authoring it here realizes, config-first, the misconfiguration the table-build warning is meant to surface, and lets a test carry the key through schema validation instead of injecting it into a table dict by hand. """ return dataclasses.replace(self, zero_based=True)
[docs] def with_merge_vcf_scores(self) -> Self: """Emit a top-level ``merge_vcf_scores: true``. With the block an override rather than a filter, a refusal keyed on a header field (gain#1258) is reachable through a block that never names that field. """ return dataclasses.replace(self, merge_vcf_scores=True)
[docs] def realize_into(self, resource_dir: pathlib.Path) -> None: """Write the resource config and the bgzipped VCF + index.""" data = self.data if self.data is not None else _VCF_DEFAULT_DATA self._validate(data) _validate_score_specs(self.scores) setup_directories( resource_dir, {GR_CONF_FILE_NAME: self._render_config()}) setup_vcf(resource_dir / _VCF_FILENAME, data, csi=self.csi) if not self.header_index: (resource_dir / _VCF_HEADER_INDEX_FILENAME).unlink() if self.index_filename is not None and self.realize_index_filename: suffix = ".csi" if self.csi else ".tbi" (resource_dir / f"{_VCF_FILENAME}{suffix}").rename( resource_dir / self.index_filename)
[docs] def build_resource(self, tmp_path: pathlib.Path) -> GenomicResource: """Realize this single resource (repo id ``""``) into ``tmp_path``.""" return _build_single_resource(self, tmp_path)
@staticmethod def _validate(data: str) -> None: """Require the header lines the scores are derived from. Without an ``##INFO`` line the resource realizes with zero scores and every annotated value comes back empty -- a silent, confusing failure well downstream of the builder. """ if "##fileformat" not in data: raise ResourceValidationError( "VCF data must carry a '##fileformat' header line") if "##INFO=" not in data: raise ResourceValidationError( "VCF data must declare at least one '##INFO=' field; the " "score definitions are derived from them") if "#CHROM" not in data: raise ResourceValidationError( "VCF data must carry a '#CHROM' column header line") def _render_config(self) -> str: zero_based_line = ( " zero_based: true\n" if self.zero_based else "") index_line = ( f" index_filename: {self.index_filename}\n" if self.index_filename is not None else "") merge_line = ( "merge_vcf_scores: true\n" if self.merge_vcf_scores else "") scores_block = ( "scores:\n" + render_score_specs_yaml(self.scores) if self.scores else "") return ( "type: allele_score\n" "table:\n" f" filename: {_VCF_FILENAME}\n" f"{index_line}" f"{zero_based_line}" f"{merge_line}" f"{scores_block}" f"{self.render_meta()}" )
_GENE_DATA_FILENAME = "data.tsv" _DEFAULT_GENE_COLUMN = "gene"
[docs] @dataclasses.dataclass(frozen=True) class GeneScoreBuilder(MetaMixin): """Immutable builder for a single ``gene_score`` resource. Built on the shared score-declaration base (:class:`ScoreSpec`): scores are declared with :meth:`with_score` (``column_name`` defaults to the score id) and validated for duplicate ids / column names exactly like a position score. The gene→value table is authored with :meth:`with_data` as a whitespace block whose header must be ``{gene_column}`` plus each declared score's ``column_name``. Realizes as a PLAIN (non-gzipped) tab-separated ``data.tsv`` table with a top-level ``filename:`` config -- mirroring the simplest working ``gene_score`` fixture. A bare builder realizes a valid minimal readable gene score: one ``float`` score and a few gene rows, with NO histogram (the numeric default histogram is auto-built when the score is read). """ scores: tuple[ScoreSpec, ...] = () data: str | None = None gene_column: str = _DEFAULT_GENE_COLUMN gzipped: bool = False
[docs] def with_score( self, score_id: str, value_type: str = "float", *, column_name: str | None = None, desc: str | None = None, ) -> GeneScoreBuilder: """Declare a gene score; ``column_name`` defaults to ``score_id``.""" return dataclasses.replace( self, scores=append_score( self.scores, score_id, value_type, column_name=column_name, desc=desc), )
[docs] def with_histogram( self, histogram: dict[str, Any], *, score_id: str | None = None, ) -> GeneScoreBuilder: """Attach a histogram block to a declared score. With ``score_id`` omitted the histogram is attached to the most-recently-declared score; passing ``score_id`` targets that score. Omitted by default: a numeric score relies on the resource's auto-built default histogram, so no ``histogram:`` block is emitted unless one is declared here. """ return dataclasses.replace( self, scores=set_histogram( self.scores, histogram, score_id=score_id), )
[docs] def with_gene_column(self, name: str) -> GeneScoreBuilder: """Set the gene-id column name (default ``"gene"``).""" return dataclasses.replace(self, gene_column=name)
[docs] def with_gzip(self) -> GeneScoreBuilder: """Realize the gene table gzipped (``.tsv.gz``) instead of plain. The default is a plain ``.tsv`` table; ``with_gzip`` gzips the TSV to ``data.tsv.gz`` and points ``filename:`` at it. The resource reads back identically to the plain form. """ return dataclasses.replace(self, gzipped=True)
[docs] def with_data(self, data: str) -> GeneScoreBuilder: """Author the gene→value table as a whitespace-separated block. Validated at the header level only: it must contain the gene column plus each declared score's ``column_name``; a missing declared column or an undeclared extra column raises ``ResourceValidationError``. """ return dataclasses.replace(self, data=data)
[docs] def realize_into(self, resource_dir: pathlib.Path) -> None: """Write this gene-score resource into ``resource_dir``. Raises a ``ResourceValidationError`` on invalid content; ``GRRBuilder`` annotates it with the resource id. """ setup_directories(resource_dir, _build_gene_score_content(self))
[docs] def build_resource( self, tmp_path: pathlib.Path, ) -> GenomicResource: """Realize this single resource (repo id ``""``) into ``tmp_path``.""" return _build_single_resource(self, tmp_path)
[docs] @dataclasses.dataclass(frozen=True) class GRRBuilder: """Immutable builder composing resources into a filesystem GRR. Resources are held behind the shared :class:`ResourceBuilder` seam, so a single GRR can compose heterogeneous resource types (e.g. a genome plus a position score). ``build_repo`` realizes each builder into its own ``root / resource_id`` directory; the id is known here, so any ``ValueError`` a builder raises is annotated with it centrally. """ resources: tuple[tuple[str, ResourceBuilder], ...] = () public_url: str | None = None
[docs] def with_public_url(self, public_url: str) -> GRRBuilder: """Advertise this GRR under ``public_url``. ``public_url`` is the address a deployment publishes its GRR at, and the only one that means anything once a rendered document or an API response leaves the server -- the repository's own url may be a directory mounted into a container. A resource's public address is this url with the resource id joined to it. """ return dataclasses.replace(self, public_url=public_url)
[docs] def with_resource( self, resource_id: str, resource_builder: ResourceBuilder, ) -> GRRBuilder: """Attach a resource, assigning its repo id here. Rejects a duplicate id fast at the call site: two resources sharing an id would realize into the same directory with the second silently winning. """ if any(rid == resource_id for rid, _ in self.resources): raise ResourceValidationError( f"duplicate resource id {resource_id!r} declared " f"more than once") return dataclasses.replace( self, resources=(*self.resources, (resource_id, resource_builder)), )
[docs] def build_repo( self, tmp_path: pathlib.Path, *, proto_id: str | None = None, ) -> GenomicResourceProtocolRepo: """Realize a filesystem GRR into ``tmp_path``. ``proto_id`` names the repository, for a caller that has to look it up by name -- a group child, whose id is how a resource is asked for. Left unset, the id is derived from the root and the advertised url. """ self.realize_all(tmp_path) return build_filesystem_test_repository( tmp_path, proto_id=proto_id, public_url=self.public_url)
[docs] def definition( self, root: pathlib.Path, *, grr_id: str = _DEFAULT_GRR_ID, ) -> dict[str, Any]: """Render this GRR as a ``dir`` repository definition. Shared by ``build_repo`` and ``build_definition`` so the in-process repository and the written yaml cannot describe different GRRs. ``public_url`` is omitted entirely when none was advertised, rather than written as an explicit null. The schema accepts either and both mean "no public mirror", but a definition a test reads back is also documentation of the shape a deployment writes -- and a deployment with no mirror simply has no such key. """ definition: dict[str, Any] = { "id": grr_id, "type": "dir", "directory": str(root), } if self.public_url is not None: definition["public_url"] = self.public_url return definition
[docs] def build_definition( self, root: pathlib.Path, *, grr_id: str = _DEFAULT_GRR_ID, ) -> pathlib.Path: """Realize into ``root/grr`` and write a ``root/grr.yaml``. Returns the path of the written definition file. A CLI tool such as ``annotate_tabular`` is given a ``--grr`` definition *file*, not a repository object, so ``build_repo`` alone cannot drive one. The definition is written OUTSIDE the resources directory: a stray ``grr.yaml`` sitting among the resources would be walked as though it were one. """ resources_dir = root / GRR_RESOURCES_DIRNAME self.realize_all(resources_dir) return write_grr_definition( root, self.definition(resources_dir, grr_id=grr_id))
[docs] def realize_all(self, root: pathlib.Path) -> None: """Realize every attached resource into ``root/<resource_id>``.""" for resource_id, builder in self.resources: resource_dir = root / resource_id try: builder.realize_into(resource_dir) except ResourceValidationError as exc: raise ResourceValidationError( f"resource {resource_id!r}: {exc}") from exc
[docs] @dataclasses.dataclass(frozen=True) class BasicResourceBuilder(MetaMixin): """Immutable builder for a single ``basic`` resource. ``basic`` is the catch-all type: no schema, no type-specific file list, whatever files the author put there. A bare builder realizes ``type: basic`` plus one placeholder ``data.txt`` payload -- the resource every repository-layout test reaches for when it needs *a* resource and does not care which -- and the config it renders for that is byte-identical to the hand-written ``"type: basic\\n"`` literal it replaces, so fixtures pinning that literal's size and md5 can move onto it. ``with_meta`` and its siblings come from :class:`MetaMixin`; :meth:`with_file` is the only knob of its own. Two exits: :meth:`build_resource` writes the resource under a ``tmp_path`` like every other builder, and :meth:`build_inmemory` hands it back with no directory at all, for a fixture that only renders the resource's page. Both realize the same content dict. """ files: tuple[tuple[str, str], ...] = ((_DATA_FILENAME, "alabala"),)
[docs] def with_file(self, filename: str, content: str) -> Self: """Add a payload file, or replace the one already carrying its name. A ``basic`` resource ships arbitrary files, so this is the only content knob it has. ``with_file("data.txt", ...)`` overwrites the default payload in place rather than adding a second entry under the same name, which the realized directory could not hold anyway. The config is not a payload: it is rendered from the type and the declared ``meta:``, and a file under its name would silently win over both, so that name is refused here -- the ``GRRBuilder`` duplicate-id precedent. """ if filename == GR_CONF_FILE_NAME: raise ResourceValidationError( f"{filename!r} is the rendered config, not a payload; " f"declare meta with with_meta, or the whole block with " f"with_raw_meta") # A dict keeps a reassigned key in its slot, which is the # replace-in-place the docstring promises. files = dict(self.files) files[filename] = content return dataclasses.replace(self, files=tuple(files.items()))
[docs] def realize_into(self, resource_dir: pathlib.Path) -> None: """Write this basic resource into ``resource_dir``.""" setup_directories(resource_dir, _build_basic_resource_content(self))
[docs] def build_resource(self, tmp_path: pathlib.Path) -> GenomicResource: """Realize this single resource (repo id ``""``) into ``tmp_path``.""" return _build_single_resource(self, tmp_path)
[docs] def build_inmemory(self) -> GenomicResource: """Realize this single resource in memory, with no ``tmp_path``. For a fixture that has no directory to write into -- the template tests render a resource's page and never touch a file. """ return build_inmemory_test_resource( _build_basic_resource_content(self))
def _build_basic_resource_content( builder: BasicResourceBuilder, ) -> dict[str, Any]: """Build the pure filesystem content dict for one basic resource. The one recipe both exits realize -- ``setup_directories`` on the filesystem, ``build_inmemory_test_resource`` in memory -- so the two cannot describe different resources. """ return { GR_CONF_FILE_NAME: "type: basic\n" + builder.render_meta(), **dict(builder.files), } def _build_single_resource( builder: ResourceBuilder, tmp_path: pathlib.Path, ) -> GenomicResource: """Realize one builder as the sole resource (repo id ``""``). Shared single-realize path for every ``ResourceBuilder.build_resource``, so all resource types route through the same GRR-builder seam. """ return ( a_grr() .with_resource("", builder) .build_repo(tmp_path) .get_resource("") ) def _realize_tabix_table( tabix_path: pathlib.Path, data: str, *, write_header: bool = True, csi: bool = False, index_filename: str | None = None, keep_conventional_index: bool = False) -> None: """Realize ``data`` as a tabix table (``.txt.gz`` + its index). With ``write_header`` (the default, the ``header_mode: file`` path) the header line is emitted as a ``#`` comment so the tabix table reads its column names from the file; ``_render_config`` then emits no ``header_mode`` key, relying on the tabix backend's default. Without it (``header_mode`` ``none``/``list``) the header line is dropped and the realized file carries data rows only. Either way the seq/start/end column indices are derived from the SAME authored header the config is rendered from, so an arbitrary column order still indexes correctly and the two cannot drift. With ``index_filename`` the index pysam wrote at its conventional name is MOVED to that name, so the resource carries the index only under the non-conventional name -- no adjacent sidecar is left behind for htslib's auto-probe to find. ``keep_conventional_index`` copies it instead, leaving the conventional sidecar in place as well -- and is refused when ``index_filename`` names that very index, because one file cannot be two. Without the flag such a name is simply already where it was asked to be, so nothing is moved. """ header = _parse_header(data) chrom_col = header.index("chrom") start_col = header.index("pos_begin") end_col = header.index("pos_end") if "pos_end" in header else start_col content = _comment_header(data) if write_header else _strip_header(data) _, written_index = setup_tabix( tabix_path, content, seq_col=chrom_col, start_col=start_col, end_col=end_col, csi=csi) if index_filename is not None: written = pathlib.Path(written_index) target = tabix_path.parent / index_filename # Compare by identity, not by spelling: ``./data.txt.gz.tbi`` and # ``../<dir>/data.txt.gz.tbi`` name the file pysam already wrote # while comparing unequal to it, and acting on one path as both # source and destination is a no-op for rename but a # SameFileError for copy. same_file = target == written or ( target.exists() and target.samefile(written)) if same_file and keep_conventional_index: raise ResourceValidationError( f"keep_conventional_index needs a SECOND name to realize " f"the configured index under, but index_filename " f"{index_filename!r} already names the conventional index " f"{written.name!r}; pass a non-conventional " f"index_filename or drop the flag") if same_file: # Already exactly where it was asked to be. return if keep_conventional_index: shutil.copyfile(written, target) else: written.rename(target) def _strip_header(data: str) -> str: """Return ``data`` without its header line.""" lines = data.split("\n") for index, line in enumerate(lines): if not line.strip(): continue return "\n".join(lines[:index] + lines[index + 1:]) return data def _comment_header(data: str) -> str: """Return ``data`` with a ``#`` prefixed onto its first header line.""" lines = data.split("\n") for index, line in enumerate(lines): stripped = line.strip() if not stripped or stripped.startswith("#"): continue indent = line[:len(line) - len(line.lstrip())] lines[index] = f"{indent}#{line.lstrip()}" break return "\n".join(lines) def _parse_header(data: str) -> list[str]: """Return the column tokens of the first non-empty data line.""" for line in data.split("\n"): stripped = line.strip() if not stripped or stripped.startswith("#"): continue return stripped.split() return [] def _validate_score_specs( scores: tuple[ScoreSpec, ...], ) -> None: """Validate the declared scores for duplicate ids or column names. A set-based check silently collapses duplicates, so two scores that share a ``score_id`` or a ``column_name`` would validate cleanly and read the same value. Reject both explicitly. """ seen_ids: set[str] = set() for spec in scores: if spec.score_id in seen_ids: raise ResourceValidationError( f"duplicate score id " f"{spec.score_id!r} declared more than once") seen_ids.add(spec.score_id) seen_columns: set[str] = set() for spec in scores: if spec.column_name is None: continue if spec.column_name in seen_columns: raise ResourceValidationError( f"duplicate column_name " f"{spec.column_name!r} shared by more than one score") seen_columns.add(spec.column_name) seen_indexes: set[int] = set() for spec in scores: if spec.column_index is None: continue if spec.column_index in seen_indexes: raise ResourceValidationError( f"duplicate column_index " f"{spec.column_index} shared by more than one score") seen_indexes.add(spec.column_index) def _resolve_column_names( scores: tuple[ScoreSpec, ...], header: list[str], ) -> set[str]: """Return the data-header column each declared score reads. A name-addressed score contributes its ``column_name``; an index-addressed one contributes ``header[column_index]``, which also range-checks the index against the authored header. An index pointing past the header would otherwise realize cleanly and fail much later, deep inside the score, with no mention of the builder. """ resolved: set[str] = set() for spec in scores: if spec.column_index is None: assert spec.column_name is not None resolved.add(spec.column_name) continue if spec.column_index >= len(header): raise ResourceValidationError( f"score {spec.score_id!r}: column_index " f"{spec.column_index} is out of range for a " f"{len(header)}-column header {header}") resolved.add(header[spec.column_index]) return resolved def _validate_data_header( data: str, scores: tuple[ScoreSpec, ...], *, base_required: tuple[str, ...], base_optional: tuple[str, ...] = (), ) -> None: """Validate the data header against the declared scores. The header must contain the ``base_required`` columns (the position columns for a position score, or the gene column for a gene score) plus each declared score's ``column_name``. A missing declared column or an undeclared extra column raises ``ResourceValidationError``. Because the builder owns the data format, a conventional ``#``-prefixed header line is rejected explicitly rather than silently skipped. """ for line in data.split("\n"): stripped = line.strip() if not stripped: continue if stripped.startswith("#"): raise ResourceValidationError( f"the data header must not start " f"with '#'; write the column names as a plain " f"whitespace-separated line (got {stripped!r})") break header = _parse_header(data) header_set = set(header) declared = _resolve_column_names(scores, header) required = set(base_required) | declared allowed = required | set(base_optional) missing = required - header_set if missing: raise ResourceValidationError( f"data header is missing required " f"column(s) {sorted(missing)}; header has {header}") extra = header_set - allowed if extra: raise ResourceValidationError( f"data header has undeclared " f"column(s) {sorted(extra)}; declared scores are " f"{sorted(declared)}") def _effective_gene_data(builder: GeneScoreBuilder) -> str: if builder.data is not None: return builder.data return """ gene score G1 0.1 G2 0.2 G3 0.3 """ def _build_gene_score_content( builder: GeneScoreBuilder, ) -> dict[str, Any]: """Build the pure filesystem content dict for one gene-score resource. Validation raises a ``ResourceValidationError``; the caller (``GRRBuilder``) annotates it with the resource id, so messages here stay id-free. """ scores = scores_or_default(builder.scores) data = _effective_gene_data(builder) _validate_score_specs(scores) colliding = [ spec.score_id for spec in scores if spec.column_name == builder.gene_column ] if colliding: raise ResourceValidationError( f"score(s) {sorted(colliding)} declare column_name " f"{builder.gene_column!r}, which is the gene column; a score " f"cannot read from the gene column -- give it a distinct " f"column_name") _validate_data_header( data, scores, base_required=(builder.gene_column,)) filename = ( f"{_GENE_DATA_FILENAME}.gz" if builder.gzipped else _GENE_DATA_FILENAME) config = textwrap.dedent(f"""\ type: gene_score filename: {filename} """) if builder.gene_column != _DEFAULT_GENE_COLUMN: config += f"gene_column: {builder.gene_column}\n" config += "scores:\n" + render_score_specs_yaml(scores) config += builder.render_meta() tsv = convert_to_tab_separated(data) table_content: str | bytes = ( gzip.compress(tsv.encode()) if builder.gzipped else tsv) return { GR_CONF_FILE_NAME: config, filename: table_content, } _GENOME_BASENAME = "chr" # A deterministic, valid minimal sequence for a bare genome (24 bases). _MINIMAL_GENOME_SEQUENCE = "ACGTACGTACGTACGTACGTACGT"
[docs] @dataclasses.dataclass(frozen=True) class ReferenceGenomeBuilder(MetaMixin): """Immutable builder for a single ``genome`` resource. Two authoring modes: * ``with_fasta(raw)`` -- author the FASTA text. The content is normalized via ``convert_to_tab_separated`` (leading indentation and blank lines are stripped, internal whitespace within a line becomes a TAB), so write single-token headers and put each chromosome's sequence on its own line(s) with no internal spaces. * ``with_chromosome(id, seq)`` -- accumulate chromosomes; the FASTA is synthesized (``>id`` header + the sequence wrapped at ``with_line_width``). The two modes are mutually exclusive: setting both raises when the genome is realized. A bare builder (neither set) realizes a valid minimal genome -- one chromosome ``"1"`` with a short deterministic sequence. Realization is bgzipped by default (``.fa.gz`` + ``.fai`` + ``.gzi``); ``as_plain()`` switches to a plain ``.fa`` + ``.fai``. """ fasta: str | None = None chromosomes: tuple[tuple[str, str], ...] = () line_width: int = 60 bgzip: bool = True index_file: str | None = None
[docs] def with_fasta(self, raw: str) -> ReferenceGenomeBuilder: """Author the genome as FASTA text (primary mode). The content is not byte-exact: it is normalized via ``convert_to_tab_separated`` (leading indentation and blank lines are stripped; internal whitespace within a line becomes a TAB). Write single-token headers (``>1``, not ``>1 description``) and put each chromosome's sequence on its own line(s) with no internal spaces. Rejects empty or whitespace-only content fast at the call site (a pysam ``SamtoolsError`` otherwise surfaces with no resource context deep inside faidx), mirroring the ``with_chromosome`` guard. """ if not raw.strip(): raise ResourceValidationError( "reference genome: FASTA content must be non-empty") return dataclasses.replace(self, fasta=raw)
[docs] def with_chromosome( self, chrom_id: str, sequence: str, ) -> ReferenceGenomeBuilder: """Accumulate one chromosome; FASTA is synthesized on realize. Rejects an empty or whitespace-only sequence fast at the call site (a pysam ``SamtoolsError`` otherwise surfaces with no resource context deep inside faidx). """ if not sequence.strip(): raise ResourceValidationError( f"chromosome {chrom_id!r}: sequence must be non-empty") return dataclasses.replace( self, chromosomes=(*self.chromosomes, (chrom_id, sequence)))
[docs] def with_line_width(self, n: int) -> ReferenceGenomeBuilder: """Set the FASTA wrapping width for the synthesized-FASTA path.""" if n <= 0: raise ResourceValidationError( f"line width must be positive, got {n}") return dataclasses.replace(self, line_width=n)
[docs] def as_plain(self) -> ReferenceGenomeBuilder: """Realize a plain (uncompressed) ``.fa`` genome instead of bgz.""" return dataclasses.replace(self, bgzip=False)
[docs] def with_index_file(self, name: str) -> ReferenceGenomeBuilder: """Publish the ``.fai`` index under ``name`` via ``index_file``. The default ``<filename>.fai`` is **renamed**, not copied, so the realized resource carries exactly one FASTA index. That is what makes a test of the ``index_file`` override meaningful: htslib and the protocol layer both fall back to the adjacent default name, so a resource that still has a ``<filename>.fai`` sitting next to the genome is read successfully even when the override is ignored entirely. """ if not name.strip(): raise ResourceValidationError( "reference genome: index_file name must be non-empty") return dataclasses.replace(self, index_file=name)
[docs] def realize_into(self, resource_dir: pathlib.Path) -> None: """Write this genome resource into ``resource_dir``. Delegates compression/indexing and the ``genomic_resource.yaml`` to the existing ``setup_genome``/``setup_genome_bgz`` helpers. """ content = self._effective_fasta() genome_path = resource_dir / self._genome_filename() if self.bgzip: setup_genome_bgz(genome_path, content) else: setup_genome(genome_path, content) self._rename_index_into(resource_dir) self.append_meta_into(resource_dir)
def _genome_filename(self) -> str: """Return the FASTA name this builder realizes.""" return f"{_GENOME_BASENAME}{'.fa.gz' if self.bgzip else '.fa'}" def _rename_index_into(self, resource_dir: pathlib.Path) -> None: """Apply the ``index_file`` override to an already-written resource. Runs after the ``setup_*`` helper, which writes (and rewrites) the ``genomic_resource.yaml`` itself -- declaring ``index_file`` before the helper runs would silently lose the key. """ if self.index_file is None: return default_index = resource_dir / f"{self._genome_filename()}.fai" target = resource_dir / self.index_file # Everything the resource realized is already on disk, so asking # whether the target is taken covers the FASTA, its .gzi and the # config without enumerating names that would drift from what # realize_into actually writes. if target != default_index and target.exists(): raise ResourceValidationError( f"reference genome: index_file {self.index_file!r} would " f"overwrite another file of the realized resource") default_index.rename(target) # safe_dump quotes a name carrying YAML syntax, so an exotic index # name lands as a value instead of corrupting the config. append_config_block(resource_dir, yaml.safe_dump( {"index_file": self.index_file}, default_flow_style=False))
[docs] def build_resource( self, tmp_path: pathlib.Path, ) -> GenomicResource: """Realize this single resource (repo id ``""``) into ``tmp_path``.""" return _build_single_resource(self, tmp_path)
def _effective_fasta(self) -> str: if self.fasta is not None and self.chromosomes: raise ResourceValidationError( "reference genome: with_fasta and with_chromosome are " "mutually exclusive; set only one authoring mode") if self.fasta is not None: return self.fasta chromosomes = self.chromosomes or (("1", _MINIMAL_GENOME_SEQUENCE),) return _synthesize_fasta(chromosomes, self.line_width)
def _synthesize_fasta( chromosomes: tuple[tuple[str, str], ...], line_width: int, ) -> str: """Render chromosomes as FASTA, wrapping each sequence at line_width.""" lines: list[str] = [] for chrom_id, sequence in chromosomes: lines.append(f">{chrom_id}") lines.extend( sequence[i:i + line_width] for i in range(0, len(sequence), line_width)) return "\n".join(lines)
[docs] def a_reference_genome() -> ReferenceGenomeBuilder: """Return an immutable reference-genome builder.""" return ReferenceGenomeBuilder()
[docs] def a_position_score() -> PositionScoreBuilder: """Return an immutable position-score builder.""" return PositionScoreBuilder()
[docs] def an_allele_score() -> AlleleScoreBuilder: """Return an immutable allele-score builder.""" return AlleleScoreBuilder()
[docs] def a_fragment_score() -> FragmentScoreBuilder: """Return an immutable fragment-score builder.""" return FragmentScoreBuilder()
[docs] def a_bigwig_score() -> BigWigScoreBuilder: """Return an immutable bigWig-backed position-score builder.""" return BigWigScoreBuilder()
[docs] def a_vcf_info_score() -> VcfInfoScoreBuilder: """Return an immutable VCF-backed allele-score builder.""" return VcfInfoScoreBuilder()
[docs] def a_gene_score() -> GeneScoreBuilder: """Return an immutable gene-score builder.""" return GeneScoreBuilder()
[docs] def a_basic_resource() -> BasicResourceBuilder: """Return an immutable ``basic`` resource builder.""" return BasicResourceBuilder()
[docs] def a_grr() -> GRRBuilder: """Return an immutable GRR-composition builder.""" return GRRBuilder()
[docs] @contextlib.contextmanager def build_repo_tempdir( grr_builder: GRRBuilder, ) -> Generator[GenomicResourceProtocolRepo, None, None]: """Realize ``grr_builder`` into a self-managed temporary directory. A ``tmp_path``-free realize form for non-pytest callers: the GRR is realized into a fresh :class:`tempfile.TemporaryDirectory`, yielded as an open repository, and the directory is removed on exit. """ with tempfile.TemporaryDirectory() as tmp_dir: yield grr_builder.build_repo(pathlib.Path(tmp_dir))
[docs] @contextlib.contextmanager def build_resource_tempdir( builder: ResourceBuilder, ) -> Generator[GenomicResource, None, None]: """Realize one ``builder`` into a self-managed temporary directory. The single-resource counterpart of :func:`build_repo_tempdir`: yields the sole realized resource and cleans the temporary directory up on exit. """ with tempfile.TemporaryDirectory() as tmp_dir: yield _build_single_resource(builder, pathlib.Path(tmp_dir))